Can we call the helix structure of DNA as its secondary structure?

Dear Student, Yes. Primary structure: sequence of bases in a strand (e.g., ATTTTCGTAAAGGCGTAAAGGCCTTTGTC….) Secondary structure: Interactions between bases to form more complex structures. DNA's secondary structure tends to be a double helix. Regards

  • 1
What are you looking for?