Select Board & Class

Login

Board Paper of Class 12-Science 2023 Biology Delhi(Set 2) - Solutions

General Instructions: 
Read the following instructions very carefully and strictly follow them:
 
(i) This question paper contains 33 questions. All questions are compulsory. 
(ii) Question paper is divided into FIVE sections - Section A, B, C, D and E
(iii) In Section A question number 1 to 16 are Multiple Choice (MCQ) type questions carrying 1 mark each. 
(iv) In Section B - question number 17 to 21 are Very Short Answer (VSA) type questions carrying 2 marks each. 
(v) In Section C - question number 22 to 28 are Short Answer (SA) type questions carrying 3 marks each. 
(vi) In Section D - question number 29 and 30 are case-based questions carrying 4 marks each. Each question has subparts with internal choice in one subpart. 
(vi) In Section E -question number 31 to 33 are Long Answer (LA) type questions carrying 5 marks each. 
(viii) There is no overall choice. However, an internal choice has been provided in 1 question in Section B, 1 question in Section C, 2 questions in Section 
D and 1 question in Section E. A candidate has to attempt only one of the alternatives in such questions. 
(ix) Wherever necessary, neat and properly labelled diagrams should be drawn.



  • Question 1
    Interferons are proteins. In humans they are secreted by:
    (a) Thymus gland
    (b) B-lymphocytes
    (c) Viral infected cells
    (d) Tonsils VIEW SOLUTION


  • Question 2
    Select the pathogen mismatched with the symptoms of disease caused by it from the list given below:
    (a) Entamoeba histolvtica: Constipation, abdominal pain.
    (b) Epidermophvton: Dry scaly lesions on nail.
    (c) Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb.
    (d) Haemophilus influenzae: Blockage of the intestinal passage. VIEW SOLUTION


  • Question 3
    The primary productivity in an ecosystem is expressed as: 
    (a) gm−2 yr−1
    (b) gm−2 yr
    (c) K cal m−2 yr−1
    (d) K cal m−2  VIEW SOLUTION


  • Question 4
    Select the option that shows the correctly identified 'U', 'X', 'Y' and 'Z' in a developing dicot embryo.

    (a) X - Plumule (2n), Y - Suspensor (n), Z - Cotyledon (2n), U - Radicle (2n).
    (b) X - Plumule (2n), Y - Suspensor (2n), Z - Radicle (2n), U - Cotyledon (2n).
    (c) X - Suspensor (2n), Y - Cotyledon (2n), Z - Radicle (2n), U - Plumule (2n).
    (d) X - Cotyledon (2n), Y - Radicle (n), Z - Plumule (n), U - Suspensor (n). VIEW SOLUTION


  • Question 5
    Given below are four aspects of Reproductive Health in Column A and their related information in Column B:
    Column A Column B
    S.No. Terms used in Reproductive Health S.No. Significant information
    (A)

    (B)
    (C)
    (D)
    MTP

    Amniocentesis
    Saheli
    Family Planning
    (i)

    (ii)
    (iii)
    (iv)
    Analysing fetal cells from amniotic fluid of the foetus
    Legalised in 1971
    Programme initiated in 1951
    Non-steroidal oral contraceptive

    Select the correct match from the following options:
    (a) (A)-(iv),     (B)-(ii),     (C)-(iii),     (D)-(i)
    (b) (A)-(ii),      (B)-(i),      (C)-(iv),     (D)-(iii)
    (c) (A)-(i),       (B)-(iii),    (C)-(ii),      (D)-(iv)
    (d) (A)-(ii),      (B)-(i),      (C)-(iii),     (D)-(iv) VIEW SOLUTION


  • Question 6
    At which stage during evolution did human use hides to protect their bodies and buried their dead?
    (a) Homo habilis
    (b) Neanderthal man
    (c) Java man
    (d) Homo erectus VIEW SOLUTION


  • Question 7
    Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
    3' AUCAGGUUUGUGAUGGUACGA 5'
    (a) Phenylalanine, Methionine
    (b) Cysteine, Glycine
    (c) Alanine, Proline
    (d) Serine, Valine VIEW SOLUTION


  • Question 8
    Interaction between clown fish living among the stinging tentacles of sea anemone is an example of-
    (a) Amensalism
    (b) Parasitism
    (c) Mutualism
    (d) Commensalism VIEW SOLUTION


  • Question 9
    Important attributes belonging to a population but not to an individual are:
    (i) Birth rate and death rate
    (ii) Male and female
    (iii) Birth and death
    (iv) Sex-ratio
    Select the correct option from the given options:
    (a) (i) only
    (b) (ii) only
    (c) (ii) and (iii)
    (d) (i) and (iv) VIEW SOLUTION


  • Question 10
    Which one of the following groups faces maximum threat of extinction?
    (a) Gymnosperms
    (b) Birds
    (c) Amphibian
    (d) Mammals VIEW SOLUTION


  • Question 11
    Given below is the restriction site of a restriction endonuclease Pst-I and the cleavage sites on a DNA molecule.

    Choose the option that gives the correct resultant fragments by the action of the enzyme Pst-I. 



    VIEW SOLUTION


  • Question 12
    Given below are the list of the commercially important products and their source organisms. Select the option that gives the correct matches.
    List A List B
    S. No. Bioactive Products S. No Microbes (Source Organism)
    (A)
    (B)
    (C)
    (D)
    Cyclosporin A
    Statins
    Streptokinase
    Penicillin
    (i) 
    (ii)
    (iii)
    (iv)
    Streptococcus
    Tricoderma polysporum
    Penicillium notatum
    Monascus purpureus

    Options:
    (a) (A)-(i), (B)-(ii), (C)-(iii), (D)-(iv)
    (b) (A)-(iii), (B)-(iv), (C)-(ii), (D)-(i)
    (c) (A)-(iv), (B)-(ii), (C)-(ii), (D)-(i)
    (d) (A)-(ii), (B)-(iv), (C)-(i), (D)-(iii) VIEW SOLUTION


  • Question 13
    Assertion (A) : Decomposition process is slower if detritus is rich in lignin and cutin.
    Reason (R) : Decomposition is largely an oxygen requiring process.
    (a) Both (A) and (R) are true and (R) is the correct explanation of (A).
    (b) Both (A) and (R) are true, but (R) is not the correct explanation of (A).
    (c) (A) is true, but (R) is false.
    (d) (A) is false, but (R) is true. VIEW SOLUTION


  • Question 14
    Assertion (A) : Determining the sex of an unborn child followed by MTP is an illegal practice.
    Reason (R) : Amniocentesis is a practice to test the presence of genetic disorders also.
    (a) Both (A) and (R) are true and (R) is the correct explanation of (A).
    (b) Both (A) and (R) are true, but (R) is not the correct explanation of (A).
    (c) (A) is true, but (R) is false.
    (d) (A) is false, but (R) is true. VIEW SOLUTION


  • Question 15
    Assertion (A) : In Thalassemia an abnormal myoglobin chain is synthesized due to a gene defect.
    Reason (R) : α-Thalassemia is controlled by genes HBA1 and HBA2 on chromosome 16.
    (a) Both (A) and (R) are true and (R) is the correct explanation of (A).
    (b) Both (A) and (R) are true, but (R) is not the correct explanation of (A).
    (c) (A) is true, but (R) is false.
    (d) (A) is false, but (R) is true. VIEW SOLUTION


  • Question 16
    Assertion (A) : Synthetic oligonucleotide polymers are used during Annealing in a PCR.
    Reason (R) : The primers bind to the double stranded DNA at their complementary regions.
    (a) Both (A) and (R) are true and (R) is the correct explanation of (A).
    (b) Both (A) and (R) are true, but (R) is not the correct explanation of (A).
    (c) (A) is true, but (R) is false.
    (d) (A) is false, but (R) is true. VIEW SOLUTION


  • Question 17
    (a) State the principle involved in separation of DNA fragments using gel electrophoresis.

    (b) How are DNA fragments visualised once they are separated by gel electrophoresis? VIEW SOLUTION


  • Question 18
    (i) Give an example of a genus of fungi that forms mycorrhizial association with plants.
    (ii) How does the plant derive benefits from this association?

    OR


    Name any two techniques used to detect the cancer of internal organs and write about any one of them. VIEW SOLUTION


  • Question 19
    The graph given below shows the number of primordial follicles per ovary in women at different ages. Study the graph and answer the questions that follow.

    (a) What is the average age of the women at the onset of menopause?
    (b) At what age are maximum primordial follicles present in the ovary, according to the given graph?  VIEW SOLUTION


  • Question 20
    "Abingdon tortoise in Galapagos islands became extinct within a decade on introduction of goats in the island." Explain giving reason. VIEW SOLUTION


  • Question 21
    By using Punnett square depict the genotypes and phenotypes of test crosses (where green pod colour (G) is dominant over yellow pod colour (g)) in Garden pea with unknown genotype. VIEW SOLUTION


  • Question 22
    Explain how did the experiment conducted by S.L. Miller substantiate that life evolved from pre-existing non-living organic molecules. VIEW SOLUTION


  • Question 23
    We all must work towards maintaining good health because 'health is wealth'. Enlist any six ways of achieving good health.

    OR


    "Plasmodium protozoan needs both a mosquito and a human host for its continuity." Explain. VIEW SOLUTION


  • Question 24
    Name and explain a surgical contraceptive method that can be adopted by the male partner of a couple. VIEW SOLUTION


  • Question 25
    ''Biodiversity plays a major role in many ecosystem services that nature provides."
    (a) Describe any two broadly utilatarian arguments to justify the given statement.
    (b) State one ethical reason of conserving biodiversity. VIEW SOLUTION


  • Question 26
    One of the major approaches of crop improvement programme is Artificial Hybridisation. Explain the steps involved in making sure that only the desired pollen grain pollinate the stigma of a bisexual flower by a plant breeder. VIEW SOLUTION


  • Question 27
    Eli Lilly's contribution for diabetic patients through r-DNA technology has been overwhelmingly accepted. Explain how? VIEW SOLUTION


  • Question 28
    Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.
    (a) Enlist any four prime goals of HGP.
    (b) Name any one common non-human animal model organism which has also been sequenced thereafter. VIEW SOLUTION


  • Question 29
    The chromosome number is fixed for all normal organisms leading to species specification whereas any abnormality in the chromosome number of an organism results into abnormal individuals. For example, in humans 46 is the fixed number of chromosomes both in male and female. In male it is '44+ XY' and in female it is '44 + XX'. Thus the human male is heterogametic, in other words produces two different types of gametes one with '22 + X' chromosomes and the other with '22 + Y' chromosomes respectively. Human female, on the other hand is homogametic i.e. produces only one type of gamete with '22 + X' chromosomes only.

    Sometimes an error may occur during meiosis of cell cycle, where the sister chromatids fail to segregate called nondisjunction, leading to the production of abnormal gametes with altered chromosome number. On fertilisation such gametes develop into abnormal individuals.

    (a) State what is aneuploidy.
    (b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome number that could possibly be produced.

    (c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 + XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder.

    OR

    (c) Name a best known and most common autosomal aneuploid abnormality in human and write any two symptoms. VIEW SOLUTION


  • Question 30

    When a microorganism invades a host, a definite sequence of events usually occur leading to infection and disease; causing suffering to the host. This process is called. pathogenesis. Once a microorganism overcomes the defense system of the host, development of the disease follows a certain sequence of events as shown in the graph. Study the graph given below for the sequence of events leading to appearance of a disease and answer the questions that follow: 



    (a) In which period, according to the graph there are maximum chances of a person transmitting a disease / infection and why ?
    (b) Study the graph and write what is an incubation period. Name a sexually transmitted disease that can be easily transmitted during this period. Name the specific type of lymphocytes that are attacked by the pathogen of this disease. 

    OR

    (b) Draw a schematie labelled diagram of an antibody
    (c) In which period, the number of immune cells forming antibodies will be the highest in a person suffering from pneumonia? Name the immune cells that produce antibodies. VIEW SOLUTION


  • Question 31
    Bioreactors are the containment vehicles of any biotechnology-based production process. For large scale production and for economic reasons the final success of biotechnological process depends on the efficiency of the bioreactor.

    Answer the following questions w.r.t. the given paragraph:
    (i) List the operational guidelines that must be adhered to so as to achieve, optimisation of the bioreactor system. Enlist any four.
    (ii) Mention the phase of the growth we refer to in the statement "Optimisation of growth and metabolic activity of the cells".
    (iii) Is the biological product formed in the bioreactor suitable for the intended use immediate? Give reason in support of your answer

    OR


    (i) 'EcoRI' has played very significant role in r-DNA technology.
     
    (I) Explain the convention for naming EcoRI.

    (II) Write the recognition site and the cleavage sites of this restriction endonuclease.

    (ii) What are the protruding and hanging stretches of DNA produced by these restriction enzymes called ? Describe their role in formation of r-DNA. VIEW SOLUTION


  • Question 32
    "It is sometimes observed that the F1 progeny shows a phenotype that resembles both the parents." Explain this type of inheritance using the example of A, B, O blood group in human.

    OR


    (i) Explain the process of aminoacylation of tRNA and its role in the process of translation.
    (ii) How does initiation of the translation process occur in prokaryotes? Explain.
    (iii) Where are the untranslated regions located on mRNA and why? VIEW SOLUTION


  • Question 33
    (i) Explain the monosporic development of embryo sac in the ovule of an angiosperm.
    (ii) Draw a diagram of the mature embryo sac of an angiospermic ovule and label any four parts in it. 

    OR


    (i) Explain the formation of placenta after the implantation in a human female.
    (ii) Draw a diagram showing human foetus within the uterus and label any four parts in it.  VIEW SOLUTION
More Board Paper Solutions for Class 12 Science Biology
What are you looking for?

Syllabus